32–44 significance and clinical application prospects

 X.Zhang,etal. Cancer Letters 481 (2020) 32–44 significance and clinical application prospects. purified using a HisTrap HP Ni sepharose (GE Healthcare Life Staphylococcalsuperantigen-likeprotein6(SSL6)isthefirstandthe Sciences, Beijing, China) with the user instructions and identified by only identified bacteria-derived protein that binds CD47 to date ITF2357 (Givinostat). It has immunoblot with anti-His antibodies. The molecular weight was cal- been reported to promote macrophage phagocytosis by competitively culated by DNASTAR 12.1 software (Woodruff Health Sciences Center binding to CD47 [29]. However, its direct effect on tumor cells is un- Library) according to the amino sequence of His-tag labeled SSL6. clear.SinceCD47canregulatetheproliferationandapoptosisoftumor Recombinant protein was treated with Detoxi-Gel endotoxin removing cells [30 3x FLAG inhibitor,31], and mediate the tolerance of HCC cells to SFN [13], we gel (Thermo Fisher Scientific, Waltham, MA, USA) following the man- speculated that SSL6 might sensitize HCC cells to SFN by blocking the ufacturer\'s instructions to eliminate endotoxins. The recombinant pro- CD47signals.Here,weaimedtoexplorethefunctionandmechanismof teinwasquantifiedwithaBCAproteinassaykit(P0012,Beyotime)and SSL6 regulating the sensitivity of HCC cells to SFN. stored at −80 °C. 2. Materials and methods 2.4. IC50analysisandcellproliferation 2.1. Celllinesandcellculture IC50andcellproliferationwereperformedwithCCK8kitaccording to the manufacturer\'s instructions (CK04, Dojindo Laboratories, 4 HumanHCCcelllines(Huh-7,MHCC97H,PLC/PRF/5,HepG2,BEL- Kumamoto, Japan) 5 × 10 cells/mL suspension was inoculated into a 7404,MHCC97L,Hep3B)andnormalhumanhepaticcelllineLO2were 96-well plate (100 μL per well) overnight at 37 °C. For IC50 experi- purchased from the Type Culture Collection of Chinese Academy of ments,eachwellwasaddeddifferentconcentrationsofSFNfor72h.In Sciences(Shanghai,China).Allcellshadbeenauthenticatedandtested the cell proliferation experiments, samples were tested at for seven forMycoplasma.ThecellswereculturedinhighglucoseDMEMmedium continuous days. The absorbance was measured at 450 nm with the (670087, Gibco, Grand Island, NY, USA) supplemented with 10% fetal Varioskan Flash Spectral Scanning Multimode Reader (Thermo Fisher bovine serum (SH30070.03, Hylcone, Thermo Fisher Scientific, Scientific, Waltham, MA, USA). Waltham, MA, USA) and 1% penicillin-streptomycin solution (ST488, Beyotime Biotechnology, Wuhan, China) at 37 °C in a humidified at- 2.5. QuantitativerealtimePCRanalysis mosphere with 5% CO . 2 5 CD47-knockdown HCC cell lines were constructed by CRISPR/Cas9 1 × 10 cells were seeded to each well of 6-well plate with in- technique. CD47 gene CDS sequence was searched with NCBI. Two dicatedtreatments 3x FLAG for sale,andcellRNAwereextractedbyRNAisoPlus(9109, specific gRNA sequences were further compared and screened out, and TaKaRa, Otsu, Shiga, Japan) according to the manufacturer\'s instruc- the designed primer sequences were as follows: tions. RNA was reversely transcribed into cDNA using takara sgCD47 F: CACCGTACCAAACTGTCCCCAGAAC PrimeScriptRTreagentKitwithgDNAEraser.QuantitativePCR(qPCR) sgCD47 R: AAACGTTCTGGGGACAGTTTGGTAC. was performed in a CFX384 system (Bio-Rad, CA, USA). β-actin was LentiCRISPRv2vectorwasusedforCD47knockoutvector(sgCD47) used as the internal control for PCR amplification to measure the ex- −ΔCt construction, competent cell transformation, and culture expansion. pression of target genes. The 2 method was used to compare and The p###http://www.glpbio.com/simage/GA11233-L-NAME-hydrochloride-2.png####lasmid was extracted with an endotoxin-free plasmid extraction quantify target genes. The primers used are shown in Supplementary kit (D6943-01, Omega Bioservices, USA). The Huh-7 and MHCC97H Table 1. cells were infected by the packaged virus collected from transfected HEK293T cells, and stable CD47-knockdown HCC cell lines were ob- 2.6. Proteinextractionandwestern-blotanalysis tained by puromycin screening. After the were washed twice with pre-cooled PBS, the total 2.2. Mice cellular proteins were extracted by radio-immunoprecipitation assay (RIPA) buffer (R0278, Sigma-Aldrich, St. Louis, MO, USA) including Five-week-old male BALB/c Nude mice were purchased from the protease inhibitors. Protein concentration was quantified by a BCA kit Chinese Academy of Medical Sciences (Beijing, China) and raised in a (P0012, Beyotime). 

 

40 μg protein samples were added to each lane, specific pathogen-free room. All animal studies were conducted in ac- resolved by SDS-PAGE and then transferred to 0.2 mm polyvinyl di- cordance with the relevant guidelines approved by the Institutional fluoride membranes. Next, the membranes were blocked in tris-buf- Animal Care and Use Committee of Army Medical University. To fered saline containing 0.05% Tween 20 (TBST) with 5% non-fat milk evaluate the toxicity of SSL6 in vivo, the peripheral blood of the mice for 1 h at 37 °C to reduce non-specific binding. After washing for three treatedwithorwithoutSSL6for21dayswascollectedfortestofblood times, the membranes were incubated overnight at 4 °C using the fol- routine,liverandkidneyfunctionintheLaboratoryMedicineCenterof lowing primary antibodies: anti-β-actin (3700, Cell Signaling Xinqiao Hospital, Army Medical University. For the xenograft tumor Technology (CST), MA, USA), anti-CD47 (63000S, CST), anti-PI3K 6 model, serum-free PBS (100 μL) containing MHCC97H cells (2 × 10 ) p110α (4249T, CST), anti-pAKT-Thr308 (4056S, CST), anti-pAKT- wassubcutaneouslyinjectedtherightflankofmiceineachgroup.After Ser473(4060T,CST),anti-HIF1α(3716S,CST),anti-HK2(2867T,CST), 12daysgrowth,mice wererandomlydividedintofourgroups:control, anti-GLUT1 (12939S, CST), anti-PFKP (8164T, CST), anti-AMPKα1 SSL6, SFN, SFN plus SSL6 as indicated in Fig. 7A. The calculation for- (AF1627, Beyotime), anti-pAMPKα-Thr172 (AA393, Beyotime), anti- 2 mula of tumor volume was (Length × Width )/2. PLCγ (5690S, CST), anti-pPLCγ (14008S, CST), anti-MRP1 (72202S, CST) and anti-MRP3 (14182S, CST). Then, cells were washed for five

 

 2.3. CloningandexpressionofrecombinantSSL6 times with TBST, the membranes were incubated with the appropriate secondaryantibodies(A0277orA0286,Beyotime)(dilutionof1:10000 The SSL6 gene was amplified by PCR based on the staphylococcus in TBST) for 1 h at room temperature. At last, an Enhanced aureusRN4420genomic nucleotidesequencewithspecificforwardand Chemiluminescence (ECL) plus Western blotting detection kit (catalog reverseprimers.AftertreatmentwiththeBamHIandHindIIIrestriction no. P0018-2, Beyotime) was used to determine target proteins. enzymes,thePCRproductwasclonedintotheexpressionvectorpQE31 and transformed into qualified Escherichia coli JM109. Recombinant 2.7. Flowcytometricanalysis SSL6waspreparedbybacterialcellsinducedby0.5mMIPTGfor4hat 37 °C. Harvested bacteria were suspended and lysised with ultrasound Huh-7 and MHCC97H cells were seeded in a 12-well plate at 4 in 20 mM Tris-HCl (pH 8.0) and 0.5 M NaCl. Recombinant SSL6 was 5×10 cellseverywellovernightat37°C.AftertreatedwithSFNand/ 33

Comments

Popular posts from this blog

Explicit Coefficient Penalization

Meta bolis mand mitochon driain polycy stick idney disease

IHCwasperformed Proteintech). Sequencing-grade trypsin (Promega, Madison, WI, USA)